Investigation of Astragalus honey and propolis extract's cytotoxic effect on two human cancer cell lines and their oncogen and proapoptotic gene expression profiles.

[Downloaded free from http://www.advbiores.net on Friday, June 12, 2015, IP: 178.157.202.174]

Original Article

Investigation of Astragalus honey and propolis extract’s cytotoxic effect on two human cancer cell lines and their oncogen and proapoptotic gene expression profiles Hojjat Sadeghi‑Aliabadi, Jamal Hamzeh, Mina Mirian Departments of Pharmaceutical Chemistry and Biotechnology, Faculty of Pharmacy, Isfahan University of Medical Sciences, Isfahan, Iran

Abstract

Background: Cancer is one of the major fatal human diseases. Natural products have been used in the treatment of cancer for long time. Bee products including honey and propolis have been introduced for malignancy treatment in recent decades. In this study cytotoxicity of bee products and their effects on the expression of proapoptotic genes have been investigated. Materials and Methods: Cytotoxic effects of Astragalus honey, ethanol extract of propolis and a sugar solution(as control) against HepG2, 5637 and L929 cell lines have been evaluated by the MTT assay. Total RNAs of treated cells were isolated and p53 and Bcl‑2 gene expression were evaluated, using real‑time PCR. Results: Propolis IC50 values were 58, 30 and 15µg/ml against L929, HepG2 and 5637, respectively. These values for honey were 3.1%, 2.4% and 1.9%, respectively. Propolis extract has increased the expression of the Bcl‑2 gene in all cell lines whereas the honey decreased that significantly(P0.05). Key Words: Apoptosis, honey, MTT assay, propolis, real time PCR

Address for correspondence: Dr.Hojjat Sadeghi‑Aliabadi, Department of Biotechnology, Faculty of Pharmacy, Isfahan University of Medical Sciences, Isfahan, Iran. E‑mail:[emailprotected] Received: 26.05.2013, Accepted: 12.05.2014

INTRODUCTION Access this article online Quick Response Code:

Website: www.advbiores.net DOI: 10.4103/2277-9175.151251

Cancer is one of the major fatal diseases to human. Chemotherapy is the most widely used approaches to cancer treatment. Long‑term use of chemotherapy can lead to drug resistance via several different mechanisms, such as gene mutation, DNA methylation and histone modification. These resistance mechanisms have been reported to play important roles in the

Copyright: © 2015 Aliabadi. This is an open‑access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

How to cite this article: Sadeghi-Aliabadi H, Hamzeh J, Mirian M. Investigation of Astragalus honey and propolis extract's cytotoxic effect on two human cancer cell lines and their oncogen and proapoptotic gene expression profiles. Adv Biomed Res 2015;4:42.

Advanced Biomedical Research | 2015 1

[Downloaded free from http://www.advbiores.net on Friday, June 12, 2015, IP: 178.157.202.174]

Sadeghi‑Aliabadi, etal.: Cytotoxic effect of Astragalus honey and propolis on cancer cells

resistance of patients with cancer to antineoplastic agents including 5‑fluorouracil, taxol, doxorubicin, cisplatin, camptothecin and etc. [1,2] Due to this resistance and also severe side effects of synthetic chemotherapeutic agents, it is important to find new natural anticancer agents in order to circumvent or moderate these adverse effects. Although more than 1400years ago, Allah in the holly Qur’an said, honey is a “healing for mankind,”[3] one thousand years later in Europe, honey and propolis were accepted as an official drug due to its antibacterial effects.[4] Honey is reported to contain about 181 substances[5] and is considered as part of traditional medicine. Caffeic acid, caffeic acid phenethyl ester and flavonoid glycons are between its most biologically active compounds, providing to have an inhibitory effect on tumor cell proliferation by different mechanisms including protein tyrosine kinase, cyclooxygenase and ornithine decarboxylase pathways.[6] The therapeutic potential of honey is gradually growing and scientific evidences for the effectiveness of honey in several experimental and clinical conditions are beginning to emerge. One of the intrinsic features of honey is its antibiotic properties, where it can be kept for long periods of time without becoming deteriorated. In addition, it has high osmotic pressure which increases the resistance to spoilage by microorganisms.[7] Honey also possessed moderate antitumor and antimetastatic effects in some different strains of rat and mouse tumors.[8] Bee honey has introduced as an inhibitor of the growth of T24, RT4, 253J and MBT‑2 bladder cancer cell lines invitro. It was also effective when administered orally in the MBT‑2 bladder cancer implantation models invivo.[9] Furthermore, honey potentiated the antitumor effects of chemotherapeutics drugs such as 5‑FU and cyclophosphamide.[10] Propolis is a sticky resin and varies in color, including brown, green and red amongst others; based upon the plant exudates that the bees have selectively collected from flower buds, leaf buds and tree barks. These plant resins are mixed with waxes and other bee excretions, including enzymes,[11] to form the final propolis product. Propolis has been extensively used in the traditional medicine for its antimicrobial activities.[12] The chemical composition of each type of propolis and its associated bioactivities mainly depend on the macro‑and micro‑geographical regions, due to the differences in the plant resin compositions or available plant species,[13,14] and on the bee species, due to the different preference for food and resin plants and for aging distances between bee species.[15] Since honey from different sources and plant species showed different activities e.g.active manuka honey exhibited good antimicrobial effects, in 2

this study the cytotoxicity and cytotoxic mechanisms of Astragalus honey (endemic to central part of Iran in Isfahan province), propolis and a modified sugar solution were evaluated against human bladder cancer cell(5637), hepatic cancer cell (HepG2) and normal mice connective tissue cell (L929). This research was done because honey’s composition and effects are different according to its source. On the other hand, to the best of our knowledge the effect of Astragalus honey has not been evaluated against cancer cell lines yet. MATERIALS AND METHODS

Sample collection Honey of Astragalus spp. and propolis was collected from Fereydoonshahr, Isfahan province, Iran and was kept in the dark at 4°C until used. Preparing of ethanolic extract of propolis Propolis extraction was prepared as reported by Najafi etal.,[16] with slight modifications. Briefly, propolis (10g) was cut into small pieces and then extracted by 95%(v/v) ethanol(100ml) at 15°C by shaking at 100rpm for 24 hours. The suspension was then centrifuged to remove the residual propolis solids. The supernatant was harvested and kept while the pellet was re‑extracted and then clarified as above. Two extracts were mixed and evaporated at 60ºC. The obtained residue (crude ethanolic extract) was stored in a dark bottle before use. Sample preparation Honey was diluted in complete media to give concentrations of 6.25, 5, 4, 3, 2, 1.5, and 0.8%w/v. 50mg of the ethanolic extract of propolis was dissolved in dimetylsulfoxide (DMSO) (1ml) and diluted with media so that the final concentrations of propolis were 125,100, 60, 50, 40, 30, 20, 15, 12.5, 10, 6.25 μg/ml (DMSO concentration in each well was kept less than 0.5%). The sugar solution was prepared by dissolving a mixture of sugars including glucose, fructose, maltose and sucrose (31%, 39%, 8% and 3%, respectively) in H2O.[17] Prepared syrup was very similar to the honey base and was used as a control. Above‑mentioned dilutions were prepared by adding complete media (Roswell park Memorial Institute; RPMI 1640, Invitrogen) and sterilized. Dilute solutions were sterilized by filtration(0.22µm) and viscose solutions under UV radiation for 20minutes. Cell culture Human hepatic carcinoma cell line (HepG2), human bladder carcinoma (5637) and mice fibroblast normal cell line(L929) were purchased from Pasteur Institute of Iran. All cell lines were cultured in RPMI 1640(Invitrogen) medium containing fetal bovine serum(FBS; 10%(v/v); Gibco) and 1% Advanced Biomedical Research | 2015

[Downloaded free from http://www.advbiores.net on Friday, June 12, 2015, IP: 178.157.202.174]

Sadeghi‑Aliabadi, etal.: Cytotoxic effect of Astragalus honey and propolis on cancer cells

% cell survival =[(mean absorbance of treated cells - mean absorbance of blank)/ (mean absorbance of control - mean absorbance of blank)] × 100 To determine IC50, concentration–response curves were generated relative to negative control. IC50 values were calculated from the linear portion of the obtained curves. Total RNA isolation and RT‑PCR Total cellular RNAs were isolated from 106cells of each cell line using RNase plus mini kit(QIAGEN) according to the manufacturer’s protocol. First‑strand cDNA was made from total RNA using QuantiTech reverse transcription kit(QIAGEN) with oligo(dT) 15 primers(QIAGEN). Expression of p53, Bcl‑2 and glyceraldehyde‑3‑phosphate dehyrogenase(GAPDH) gene were examined in three cell lines. The primers’ sequences of the genes are as follows: Bcl‑2 forward primer: 5’‑ATCAGGAAGGCTAGAGTT‑3’ Bcl‑2 reverse primer: 5’‑TCGGTCTCCTAAAAGCAGGC‑3’ GAPDH forward primer: 5’‑ GAAGGTGAAGGTCGG AGTCA‑3’ GAPDH reverse primer: 5’‑ GAAGATGGTGATGGG ATTTC‑3’

RESULTS

Antiproliferation studies Propolis extracts

Propolis was obtained as a sticky brownish to dark brown resin with a distinctive smell. Its cytotoxic effects were evaluated against tested cell lines, using the MTT assay. IC50 values were 58, 30 and 15 μg/ml against L929, HepG2 and 5637, respectively[Figure1]. Astragalus honey and sugar solutions Cytotoxic effects of various concentrations of Astragalus honey were evaluated against tested cell lines after an incubation of 48 hours. IC50s were measured in concentrations containing 3.1%,

SURSROLVFRQFHQWUDWLRQJPO

FHOOVXUYLYDORIFRQWURO

Cytotoxicity assay 180 µl of each cell suspension(5×104cells/ml) in complete media were transferred into each well of a U‑bottom 96 well microplate(Orange; Belgium) and then incubated at 37°C for 24 hours. Old media were replaced with fresh one containing 20 µl of different concentrations of propolis extract, honey or sugar solution (4 wells for each concentration). 20 µl of doxorubicin solution (EBEWE Pharma, Austria) was added to the wells which assumed as positive control. The plate was incubated for 48 h at the same conditions and cell survival was determined by the MTT (3‑(4,5‑dimethylthiazol‑2‑yl)‑2,5‑diphenyltetrazolium bromide)assay as mentioned before.[18] Percentage of cell survival was calculated using following equation:

FHOOVXUYLYDORIFRQWURO

FRQFHQWUDWLRQZY

Figure2: Cytotoxic effects of different concentrations of honey and sugar solution on L929, 5637 and HepG2 cell lines. Cell viability was assessed using the MTT assay. Data are presented as mean ± SD of cell survival compared with negative control (cell survival assumed 100%). In L929 and 5637 treated with honey, significant differences (P < 0.05) were observed for concentrations of ≤ 0.8 % w/v (as seen in graphs). Significant differences were seen when HepG2 exposed to honey (P < 0.05), whereas no significance was observed in the presence of sugar solutions (P ≥ 0.05) 4

Advanced Biomedical Research | 2015

[Downloaded free from http://www.advbiores.net on Friday, June 12, 2015, IP: 178.157.202.174]

Sadeghi‑Aliabadi, etal.: Cytotoxic effect of Astragalus honey and propolis on cancer cells

5HODWLYHO\JHQHH[SUHVVLRQ

decreased the expression of the p53 gene by 80% and 40%, respectively, while the sugar solution increased that by two‑fold [Figure8].

5HODWLYHO\JHQHH[SUHVVLRQ

in HepG2cells while sugar increased that more than 2.5‑fold compared to untreated cells[Figure6]. p53 gene expressions in L929cells were decreased to half by honey and no changes were seen when cells treated with propolis and sugar solution [Figure7]. 5637cells showed a different pattern so that honey and propolis

1RQWUHDWHG +HS*

+RQH\ +HS*

SURSROLV +HS*

VXJHU +HS*

H +RQ

OLV RSR

U JD

Figure4: 5637 cells treated with honey, propolis and sugar (For detail see material and methods section) UHODWLYHO\JHQHH[SUHVVLRQ

Figure3: HepG2 Cell exposed to honey, sugar and propolis (see the material and methods section for details)

* HS + G H W HD QWU QR

QRQWUHDWHG/ KRQH\/ SURSROLV/ VXJDU/ Figure5: L929 cells treated with honey, propolis and sugar (For detail see material and methods section)

J * HS HS + + V L \ O QH SR KR SUR

* HS + U JD VX

Figure6: HepG2 cells treated with honey, propolis and sugar solution (For detail see material and methods section) UHODWLYHO\JHQHH[SUHVVLRQ

UHODWLYHO\ JHQH H[SUHVVLRQ

UHODWLYHO\JHQHH[SUHVVLRQ

G/ HDWH

WU QRQ

/ QH\

S SUR

/ ROLV

/ JDU

Figure7: L929 cells treated with honey, propolis and sugar solution (For detail see material and methods section)

KRQH

OLV

SUSR

VXJ

Figure8: 5637cells treated with honey, sugar solutions and propolis (For detail see material and methods section)

Advanced Biomedical Research | 2015 5

[Downloaded free from http://www.advbiores.net on Friday, June 12, 2015, IP: 178.157.202.174]

Sadeghi‑Aliabadi, etal.: Cytotoxic effect of Astragalus honey and propolis on cancer cells

DISCUSSION

Honey as a traditional medicine and dietary natural product has recently become the focus of attention in the treatment of certain diseases as well as promoting overall health and well‑being. There is strong evidence supporting the positive role of natural food and food product on the induction of apoptosis in different tumor cells.[19] In this regard, we investigated the antiproliferative and apoptotic activities(in gene expression level) of Astragalus honey and propolis on human 5637, HepG2 and mice L929 cell lines and compared with a sugar solution. We found that honey was about two‑fold more cytotoxic toward cancer cells than L929 as a normal cell line. The IC50 for honey was 3.12, 2.4 and 1.9% against L929, HepG2 and 5637, respectively. These effects were dose dependent. In the oral health setting, honey has been found to be effective for the treatment of radiation‑induced oral mucositis[20] and is also found to be anticarcinogenic,[21] antiproliferative and induces apoptosis in prostate cancer cells.[19] This is consistent with results of the present study. The honey tested in this study has been originally produced in Iran, Isfahan province, and sold as “natural honey of Astragalus” in the local markets. According to our best knowledge, Astragalus honey and its propolis have not been reported to test against cancer cells. While most of the previous studies on honey have focused on its anti‑microbial and wound‑healing properties, only few studies have investigated the anticarcinogenic properties of honey. Gribel and Pashinskii reported that honey revealed moderate antitumor and pronounced antimetastatic effects. Their results also showed that the antitumor activity of 5‑fluorouracil and cyclophosphamide has been increased in combination with honey.[8] Honey was inhibited the growth of bladder cancer cell lines invitro, and bladder cancer implanted mice models invivo.[22] The present study showed that unfractionated Astragalus honey and propolis had antiproliferative effects against HepG2, 5637 cancer cells and normal L929 cell line in a time‑and concentration‑dependent manner. Antiproliferative activity of honey may relate to its low pH(3.2-4.6). It was suggested that the polyphenols found in honey, including Caffeic acid, and its phenyl esters, present in natural honey at the levels of 20‑25%, to be promising pharmacological agents in the treatment of cancer by reviewing their antiproliferative and molecular mechanisms. [23] These compounds are thought to exhibit a broad spectrum of activity including tumor inhibition [6] by downregulation of many cellular enzymatic pathway including protein tyrosine kinas cycloxygenase and ornitine decarboxylase pathways.[24] Jungle honey obtained from the tropical forest of Nigeria showed chemotactic activity for neutrophils, 6

which were found to possess potent antitumor activity. [25] Moreover, the expression of various proapoptotic and antiapoptotic proteins was found to be altered during apoptosis.[26] Unfractionated honey was induced cell‑growth arrest, resulting in cell cycle blockage at the sub‑G1 phase.[27] Bcl‑2 was first identified as an oncogene translocated from chromosome 18 to the heavy chain immunoglobin locus of chromosome 14 in B‑cell follicular lymphoma.[28] Overexpression of Bcl‑2 inhibits apoptosis induced by a variety of circumstances including growth factor such as tumor necrosis factor Alfa (TNF α) receptor ligation, or by conflicting sub‑cellular signaling events.[29] Our study showed that expression of Bcl‑2 was decreased in HepG2 and 5637 cancer cell but not in L929 normal cells [Figures3‑5]. This phenomenon may be responsible for the increasing cytotoxicity of cancer cells probably via apoptosis. Recent studies show that Bcl‑2 is over expressed in many types of tumors, especially in relapsed or chemo resistant malignancies[30,31] therefore it was an important target for a selective novel cancer therapy.[32] In support of these data, several researchers have shown that honey components can induce apoptosis through a large number of mechanisms, including Bcl‑2 regulation.[33] The p53(phosphoprotein 53‑kDa) is a tumor‑suppressor gene located at the short arm of the chromosome 17 and act as a transcription factor. Its important role in tumor development has been attested by numerous reports stating that p53 is the most commonly altered gene in human cancer. More than 50% of human cancers have a defect in the p53 gene.[34] Our data demonstrated that although Bcl‑2 expression was decreased significantly in cells treated with honey but the expression of the p53 gene was not upregulated. It has been already reported that cell cytotoxicity observed by treatment of cells with propolis was not related to gene expression.[35] In this regard we found that gene expression level was not changed significantly in cancer and normal cells while exposed to propolis extract. It seems that some other mechanisms are involved. CONCLUSION

By downregulation of Bcl‑2 expression it could be concluded that the cytotoxicity of honey was more than two‑fold against tested cancer cells when compared with a sugar solution. No significant changes were observed in the expression of p53 in honey‑treated cells. Propolis had no significant effect on Bcl‑2 and p53 gene expressions(P>0.05). Advanced Biomedical Research | 2015

[Downloaded free from http://www.advbiores.net on Friday, June 12, 2015, IP: 178.157.202.174]

Sadeghi‑Aliabadi, etal.: Cytotoxic effect of Astragalus honey and propolis on cancer cells

ACKNOWLEDGEMENTS The authors would like to thank Mrs. Moazzen for her help and technical support. REFERENCES 1. 2. 3. 4. 5. 6. 7. 8. 9. 10.

11. 12. 13. 14. 15. 16. 17. 18.

MaJ, DongC, JiC. MicroRNA and drug resistance. Cancer Gene Ther 2010;17:523‑31. SarkarFH, BanerjeeS, LiY. Pancreatic cancer: Pathogenesis, prevention and treatment. Toxicol Appl Pharmacol 2007;224:326‑36. The holy Quran. Chapter16. Surat‑al‑Nahl, ayat 69. CastaldoS, CapassoF. Propolis, an old remedy used in modern medicine. Fitoterapia 2002;73 Suppl1:S1‑6. WhiteJW, CraneE. Honey: AComprehensive Survey. London: Heinemann Publisher; 1979. p.157‑207. RaoCV, DesaiD, SimiB, KulkarniN, AminS, ReddyBS. Inhibitory effect of caffeic acid esters on azoxymethane‑induced biochemical changes and aberrant crypt foci formation in rat colon. Cancer Res 1993;53:4182‑8. Kamran AzimM, Ahmed MesaikM, SimjeeS, AuranzebM, Nazimuddi, Arshad SaeedS. Medicinal properties of honey from northern Pakistan. Malays J Med Sci 2007;14:110. GribelNV, PashiniskiVG. Antitumor properties of honey. Vopr Onkol 1990;36:704‑9. SwellamT, MiyanagaN, OnozawaM, HattoriK, KawaiK, ShimazuiT, etal. Antineoplastic activity of honey in an experimental bladder cancer implantation model: Invivo and invitro studies. Int J Urol 2003;10:213‑9. WattenbergLW. Chemoprevention of cancer by naturally occurring and synthetic compounds. In: WattenbergM, LipkinCW, BooneCW, KelloffGJ, editors. Cancer Chemoprevention, Boca Raton, Florida: CRC Press; 1992. p.19‑39. BankovaVS, De CastroSL, MarcucciMC. Propolis: Recent advances in chemistry and plant origin. Apidologie 2000;31:3‑15. BanskotaAH, TezukaY, KadotaS. Recent progress in pharmacological research of propolis. Phytother Res 2001;15:561‑71. KucukM, KolayliS, KaraogluS, UlusoyE, BaltaciC, CandanF. Biological activities and chemical composition of three honeys of different types from Anatolia. Food Chem 2007;100:526‑34. SiliciS, KutlucaS. Chemical composition, antibacterial activity of propolis collected by three different races of honeybees in the same region. JEthnopharmacol 2005;99:69‑73. PratsinisH, KletsasD, MelliouE, ChinouI. Antiproliferative activity of Greek propolis. JMed Food 2010;13:286‑90. NajafiMF, VahedyF, SeyyedinM, JomehzadehHR, BozaryK. Effect of the water extracts of propolis on stimulation and inhibition of different cells. Cytotechnology 2007;54:49‑56. BeraA, AlmeidaM, SabatoSF. Effect of gamma radiation on honey quality control. Radiat Phys Chem 2009;78:583‑4. Sadeghi‑aliabadi H, AliasgharluoM, Mirian M and GhanadianM. In vitro cytotoxic evaluation of some synthesized COX‑2 inhibitor derivatives against a panel of human cancer cell lines. Res Pharm Sci 2013;8:299‑304.

19. SamarghandianS, Afshari JT, Davoodi S. Chrysin reduces proliferation and induces apoptosis in human prostate cancer cell line PC3. Clinics (Sao Paulo) 2011;66:1073‑9. 20. BiswalBM, ZakariaA, AhmadNM. Topical application of honey in the management of radiation mucositis. a preliminary study. Support Care Cancer 2003;11:242‑8. 21. SelaM, MarozD, GedaliaI. Streptococcus mutans in saliva of normal subjects and neck and head irradiated cancer subjects after consumption of honey. JOral Rehabil 2000;27:269‑70. 22. SwellamT, MiyanagaN, OnozawaM, HattoriK, KawaiK, ShimazuiT, etal. Antineoplastic activity of honey in an experimental bladder cancer implantation model. In vivo and invitro studies. Int J Urol 2003;10:213‑9. 23. JaganathanSK, MandalM. Antiproliferative effects of honey and of its polyphenols. Areview. JBiomed Biotechnol 2009;2009:830616. 24. RaoCV, DesaiD, SimiB, KulkarniN, AminS, ReddyBS. Inhibitory effect of caffeic acid esters on azoxymethane‑induced biochemical changes and aberrant crypt foci formation in rat colon. Cancer Res 1993;53:4182‑8. 25. FukudaM, KobayashiK, HironoY, MiyagawaM, IshidaT, EjioguEC, etal. Jungle Honey Enhances Immune Function and Antitumor Activity. Evid Based Complement Alternat Med 2011;2011:908743. 26. GhashmAA, OthmanNH, KhattakMN, IsmailNM, SainiR. Antiproliferative effect of Tualang honey on oral squamous cell carcinoma and osteosarcoma cell lines. BMC Complement Altern Med 2010;10:49. 27. JaganathanSK, MandalM. Involvement of non‑protein thiols, mitochondrial dysfunction, reactive oxygen species and p53 in honey induced apoptosis. Invest New Drugs 2010;28:624‑33. 28. TsujimotoY, CroceCM. Analysis of the structure, transcripts, and protein products of Bcl‑2, the gene involved in human follicular lymphoma. Proc Natl Acad Sci U S A 1986;83:5214‑8. 29. YangE, KorsmeyerSJ. Molecular thanatopsis: Adiscourse on the Bcl‑2 family and cell death. Blood 1996;88:386‑401. 30. ReedJC, MiyashitaT, KrajewskiS, TakayamaS, Aime‑SempeC, KitadaS, etal. Bcl‑2 family proteins and the regulation of programmed cell death in leukemia and lymphoma. Cancer Treat Res 1996;84:31‑72. 31. BornerMM, BroussetP, Pfanner‑MeyerB, BacchiM, VonlanthenS, HotzMA, etal. Expression of apoptosis regulatory proteins of the Bcl‑2 family and p53 in primary resected non‑small‑cell lung cancer. Br J Cancer 1999;79:952‑8. 32. AnJ, ChenY, HuangZ. Critical upstream signals of cytochrome C release induced by a novel Bcl‑2 inhibitor. JBiol Chem 2004;279:19133‑40. 33. LinJG, ChenGW, LiTM, ChouhST, TanTW, ChungJG. Aloe‑emodin induces apoptosis in T24 human bladder cancer cells through the p53 dependent apoptotic pathway. JUrol 2006;175:343‑7. 34. BaiL, ZhuWG. p53: Structure, Function and therapeutic applications. JCancer Mol 2006;2:141‑53. 35. SupawadeeU, Preecha Ph, SongchanP, ChanpenCH. In vitro antiproliferative activity of partially purified Trigona laeviceps propolis from Thailand on human cancer cell lines. BMC Complement Altern Med 2011;11:37. Source of Support: Nil, Conflict of Interest: None declared.

Advanced Biomedical Research | 2015 7

Investigation of Astragalus honey and propolis extract's cytotoxic effect on two human cancer cell lines and their oncogen and proapoptotic gene expression profiles. - PDF Download Free (2024)